This is an R Markdown document. Markdown is a simple formatting syntax for authoring HTML, PDF, and MS Word documents. For more details on using R Markdown see http://rmarkdown.rstudio.com.
This project makes use of many packages, especially Phyloseq https://joey711.github.io/phyloseq/.
The goal of this document it to provide a comprehensive overview of all methods used in the paper for visualizing amplicon data.
library("knitr")
library(checkpoint)
checkpoint("2017-09-01", use.knitr = T)
library("rmarkdown")
library("formatR")
library("ggplot2")
library("phyloseq")
# Checkpoint can't install phyloseq, so install like this:
#source('http://bioconductor.org/biocLite.R'); biocLite('phyloseq',suppressUpdates = T)
library("RColorBrewer")
library("viridis")
library("scales")
library("cowplot")
library("vegan")
library("dplyr")
library("multcomp")
library("reshape2")
library("picante")
library("betapart")
#library("parallel")
library("tidyr")
library("broom")
#('phyloseq')
theme_set(theme_bw() + theme(strip.background = element_blank()))
set.seed(711)
knitr::opts_chunk$set(cache=TRUE)
Our work here will focus on two amplicon data sets. One from the 16S gene, the other from the 18S gene. Because there amplicons came from different primers and are expected to target different genes (of different evolutionary history, length, complexity, etc) they will be analyzed separately. (This also makes the stats simpler.)
meta <- import_qiime_sample_data(file.path('../data/metadata.txt'))
no_meta <- import_biom(file.path('../data/16S_otus_vsearch/otu_table_w_tax_silva.biom'),
file.path('../data/16S_otus_vsearch/rep_set.tre'))
full16s <- merge_phyloseq(meta, no_meta)
full16s
## phyloseq-class experiment-level object
## otu_table() OTU Table: [ 3234 taxa and 91 samples ]
## sample_data() Sample Data: [ 91 samples by 9 sample variables ]
## tax_table() Taxonomy Table: [ 3234 taxa by 7 taxonomic ranks ]
## phy_tree() Phylogenetic Tree: [ 3234 tips and 3232 internal nodes ]
no_meta_18s <- import_biom(file.path('../data/18S_otus_vsearch/otu_table_w_tax_silva.biom'),
file.path('../data/18S_otus_vsearch/rep_set.tre'))
full18s <- merge_phyloseq(meta, no_meta_18s)
full18s
## phyloseq-class experiment-level object
## otu_table() OTU Table: [ 2861 taxa and 77 samples ]
## sample_data() Sample Data: [ 77 samples by 9 sample variables ]
## tax_table() Taxonomy Table: [ 2861 taxa by 7 taxonomic ranks ]
## phy_tree() Phylogenetic Tree: [ 2861 tips and 2859 internal nodes ]
Let’s take a look at columns in the metadata file. Also fix strange columns.
# Let's use 16S, as it's our main focus, and has more samples.
meta <- sample_data(full16s)
meta.n_unique <- rapply(meta, function(x) length(table(x)))
# The pairwise interesting factors
meta.n_unique[meta.n_unique == 2]
## named integer(0)
# Other potentially interesting factors
meta.n_unique[meta.n_unique > 2 & meta.n_unique < max(meta.n_unique)]
## Day Timepoint
## 6 6
sample_data(full16s)$Day <- factor(sample_data(full16s)$Day)
sample_data(full18s)$Day <- factor(sample_data(full18s)$Day)
Remove all non-bacteria microbes, along with off-target effects of the 16S primers, like OTUs annotated as chloroplasts or mitochondria.
Rarefy and select Days 8-79 as a cohort for downstream analysis. The initial day of sampling had very little biomass on the slides, and very few samples were successfully sequenced. Day 8 will be the initial day analyzed.
filtered16s <- subset_taxa(full16s, Rank1 == "D_0__Bacteria")
ntaxa(filtered16s) / ntaxa(full16s)
## [1] 0.9094001
sum(taxa_sums(filtered16s)) / sum(taxa_sums(full16s))
## [1] 0.9961169
# What taxa are being removed in this filter?
full16s %>% subset_taxa(Rank1 != "D_0__Bacteria") %>% tax_table %>% data.frame %>% select_("Rank1") %>% table
## .
## D_0__Archaea Unassigned
## 102 191
# Mostly Archaea and Unassigned microbes.
filtered16s <- subset_taxa(filtered16s, Rank5 != "D_4__Mitochondria")
ntaxa(filtered16s) / ntaxa(full16s) # about 4% are mirochondria
## [1] 0.8574521
sum(taxa_sums(filtered16s)) / sum(taxa_sums(full16s))
## [1] 0.9404225
# Just to be sure, let's also filter at the class level.
filtered16s <- subset_taxa(filtered16s, Rank4 != "D_3__Chloroplast")
ntaxa(filtered16s) / ntaxa(full16s) # another 2% are chloroplast
## [1] 0.8345702
sum(taxa_sums(filtered16s)) / sum(taxa_sums(full16s))
## [1] 0.6990603
# Lot's of c__Chloroplast in these samples!
plot(sort(sample_sums(filtered16s)))
#ggplot(sample_data(filtered16s), aes(sample_sums(filtered16s))) + geom_histogram(binwidth = 10000, aes(fill=Day))
sort(sample_sums(filtered16s))[1:30]
## T6.12 T4.13 T1..2.7 T1..14.19 T3.11 T4.5 T4.10
## 0 1 1 1 1 2 4
## T5.16 T3.19 T3.3 T6.15 T3.5 T4.20 T3.18
## 4 11 15 19 28 36 307
## T1.1 T2.1 T4.18 T5.5 T3.7 T6.14 T5.8
## 356 937 2239 7721 8090 13168 13978
## T5.3 T5.6 T6.11 T3.20 T3.2 T6.6 T6.18
## 17533 18996 20605 20792 26188 29167 29539
## T6.17 T4.3
## 29569 31461
set.seed(711)
rar.16s <- rarefy_even_depth(filtered16s, sample.size = 13000, replace = F)
## You set `rngseed` to FALSE. Make sure you've set & recorded
## the random seed of your session for reproducibility.
## See `?set.seed`
## ...
## 19 samples removedbecause they contained fewer reads than `sample.size`.
## Up to first five removed samples are:
## T4.18T4.10T4.13T5.5T1..2.7
## ...
## 383OTUs were removed because they are no longer
## present in any sample after random subsampling
## ...
rar.16s
## phyloseq-class experiment-level object
## otu_table() OTU Table: [ 2316 taxa and 72 samples ]
## sample_data() Sample Data: [ 72 samples by 9 sample variables ]
## tax_table() Taxonomy Table: [ 2316 taxa by 7 taxonomic ranks ]
## phy_tree() Phylogenetic Tree: [ 2316 tips and 2314 internal nodes ]
rar.16s.cohort <- subset_samples(rar.16s, Day %in% c(8,14,35,56,79))
rar.16s.cohort
## phyloseq-class experiment-level object
## otu_table() OTU Table: [ 2316 taxa and 71 samples ]
## sample_data() Sample Data: [ 71 samples by 9 sample variables ]
## tax_table() Taxonomy Table: [ 2316 taxa by 7 taxonomic ranks ]
## phy_tree() Phylogenetic Tree: [ 2316 tips and 2314 internal nodes ]
18S is handled similarly. A different set of off-target effects for 18S primers are used.
# Now that we are using a unified database, also filter Mitochondria and
# chloroplasts on the 18S amplicons
filtered18s <- subset_taxa(full18s, Rank5 != "D_4__Mitochondria")
ntaxa(filtered18s) / ntaxa(full18s) # more than 25% of OTUs are mitochondria
## [1] 0.769661
sum(taxa_sums(filtered18s)) / sum(taxa_sums(full18s)) # but < 4% of reads
## [1] 0.9626478
filtered18s <- subset_taxa(filtered18s, Rank4 != "D_3__Chloroplast")
ntaxa(filtered18s) / ntaxa(full18s) # < 0.1% are chloroplast
## [1] 0.7693114
sum(taxa_sums(filtered18s)) / sum(taxa_sums(full18s))
## [1] 0.9623338
# Remove 'tomatoes' (actually from two types of bacteria).
# badTaxa <- full18s %>% subset_taxa(Rank7 == "D_12__Solanum lycopersicum (tomato)") %>% taxa_names
# allTaxa <- taxa_names(full18s)
# keepTaxa <- allTaxa[!(allTaxa %in% badTaxa)]
# filtered18s <- prune_taxa(keepTaxa, full18s)
# ntaxa(filtered18s) / ntaxa(full18s)
# sum(taxa_sums(filtered18s)) / sum(taxa_sums(full18s))
plot(sort(sample_sums(filtered18s)))
#ggplot(sample_data(filtered18s), aes(sample_sums(filtered18s))) + geom_histogram(binwidth = 10000, aes(fill=Day))
sort(sample_sums(filtered18s))[1:30]
## T3.9 T1..14.19 T6.20 T1.1 T6.18 T6.19 T3.6
## 2784 3050 3443 3684 5606 10421 12508
## T6.6 T6.14 T4.5 T2..2.5 T3.14 T4.16 T3.10
## 24621 32298 34006 52080 58053 61908 62288
## T3.20 T2.1 T2..6.10 T3.12 T5.3 T3.2 T3.11
## 65432 69392 77388 77535 77905 82809 83787
## T4.8 T3.8 T4.20 T4.9 T3.4 T4.10 T6.11
## 83806 88123 91494 98421 99726 100639 100844
## T3.13 T6.2
## 101150 103740
set.seed(711)
rar.18s <- rarefy_even_depth(filtered18s, sample.size = 13000, replace = F)
## You set `rngseed` to FALSE. Make sure you've set & recorded
## the random seed of your session for reproducibility.
## See `?set.seed`
## ...
## 7 samples removedbecause they contained fewer reads than `sample.size`.
## Up to first five removed samples are:
## T6.19T6.20T6.18T1..14.19T1.1
## ...
## 499OTUs were removed because they are no longer
## present in any sample after random subsampling
## ...
rar.18s
## phyloseq-class experiment-level object
## otu_table() OTU Table: [ 1702 taxa and 70 samples ]
## sample_data() Sample Data: [ 70 samples by 9 sample variables ]
## tax_table() Taxonomy Table: [ 1702 taxa by 7 taxonomic ranks ]
## phy_tree() Phylogenetic Tree: [ 1702 tips and 1700 internal nodes ]
rar.18s.cohort <- subset_samples(rar.18s, Day %in% c(8,14,35,56,79))
rar.18s.cohort
## phyloseq-class experiment-level object
## otu_table() OTU Table: [ 1702 taxa and 69 samples ]
## sample_data() Sample Data: [ 69 samples by 9 sample variables ]
## tax_table() Taxonomy Table: [ 1702 taxa by 7 taxonomic ranks ]
## phy_tree() Phylogenetic Tree: [ 1702 tips and 1700 internal nodes ]
The main feature is Day, with most samples from later days.
Looks like we lost samples throughout. Mostly the loss near the start is more noticeable.
How many Phyla and OTUs are in the initial Day 8 samples?
rar.16s.cohort %>% subset_samples(Day == "8") %>% filter_taxa(function(x){max(x) > 0 }, prune = T) %>% tax_glom("Rank2") %>% ntaxa
## [1] 37
rar.18s.cohort %>% subset_samples(Day == "8") %>% filter_taxa(function(x){max(x) > 0 }, prune = T) %>% tax_glom("Rank3") %>% ntaxa
## [1] 16
rar.16s.cohort %>% subset_samples(Day == "8") %>% filter_taxa(function(x){max(x) > 0 }, prune = T) %>% ntaxa
## [1] 1013
rar.18s.cohort %>% subset_samples(Day == "8") %>% filter_taxa(function(x){max(x) > 0 }, prune = T) %>% ntaxa
## [1] 816
I’ll use rarefied data, for consistency.
Beta Diversity was investigated, but not included in final paper.
PyNAST alignments to the Greengenes and Silva database were used for both 16S and 18S data, respectively. ML Tree was built using FastTree2.
Viridis is in vogue, and looks pretty good here.
bray.16s = ordinate(rar.16s.cohort, method = "PCoA", distance = "bray")
bray.18s = ordinate(rar.18s.cohort, method = "PCoA", distance = "bray")
plot_ordination(rar.16s.cohort, bray.16s, color="Day") + v
plot_ordination(rar.18s.cohort, bray.18s, color="Day") + pl
metrics <- c("Observed", "SimpsonE")
rich.16s <- estimate_richness_mod(rar.16s.cohort, measures = metrics)
rich.18s <- estimate_richness_mod(rar.18s.cohort, measures = metrics)
# Rename for graphing
graphnames <- c("Richness", "Evenness")
names(rich.16s) <- graphnames
names(rich.18s) <- graphnames
# merge richness with metadata
DF.16s <- merge(rich.16s, sample_data(rar.16s.cohort), by = 0)
DF.18s <- merge(rich.18s, sample_data(rar.18s.cohort), by = 0)
# melt for graphing
reshapevars <- c("Richness", "Evenness")
mdf.16s = reshape2::melt(DF.16s, measure.vars = graphnames)
mdf.18s = reshape2::melt(DF.18s, measure.vars = graphnames)
alpha.16s.alt <- ggplot(mdf.16s, aes(Day, value, color = Day))
alpha.16s.alt <- alpha.16s.alt +
geom_boxplot(color = "gray", outlier.size = 0) +
geom_jitter(width = 0.2) +
facet_grid(facets = variable~., scales = "free_y", switch = "y") +
labs(x = "Sampling Day", title = "16S OTUs") +
v + theme(legend.position = "none",
strip.background = element_blank(),
axis.title.y = element_blank(),
strip.placement = "outside"
#, plot.margin=unit(c(5,5,-25,5), units = "pt")
)
alpha.16s.alt
alpha.18s.alt <- ggplot(mdf.18s, aes(Day, value, color = Day))
alpha.18s.alt <- alpha.18s.alt +
geom_boxplot(color = "gray", outlier.size = 0) +
geom_jitter(width = 0.2) +
facet_grid(facets = variable~., scales = "free_y", switch = "y") +
labs(x = "Sampling Day", title = "18S OTUs") +
pl + theme(legend.position = "none",
strip.background = element_blank(),
axis.title.y = element_blank(),
strip.text.y = element_blank()
#axis.text.y = element_blank()
#, plot.margin=unit(c(5,5,-25,5), units = "pt")
)
alpha.18s.alt
alpha.both.alt <- plot_grid(alpha.16s.alt, alpha.18s.alt,
#labels = c("A", "B"),
align = "h", nrow = 1, rel_widths = c(1.1, 1))
alpha.both.alt
ggsave("./figures/alpha.both.pdf", alpha.both.alt, scale = 1.3, width = 89, height = 77, units = "mm")
Pairwise comparison between groups using multcomp::glht()
# Simple means
DF.16s %>% group_by(Day) %>% summarize(meanRich = mean(Richness), meanEven = mean(Evenness))
## # A tibble: 5 x 3
## Day meanRich meanEven
## <fctr> <dbl> <dbl>
## 1 8 557.7500 0.02254974
## 2 14 591.0714 0.02702905
## 3 35 586.1176 0.02391469
## 4 56 225.6667 0.01199354
## 5 79 233.3889 0.02940754
1 - 233.3889 / 557.7500 # richness decrease between Day 8 and 79
## [1] 0.5815528
0.02940754 / 0.02391469 - 1 # Evenness increase between Day 35 and 79
## [1] 0.2296852
#DF.16s %>% ggplot(aes(x = Richness)) + geom_dotplot() + facet_grid(Day~.)
DF.16s %>% glm(Richness ~ Day, family = "poisson", data = .) %>%
glht(linfct = mcp(Day = "Tukey")) %>% summary %>% tidy %>% kable
| lhs | rhs | estimate | std.error | statistic | p.value |
|---|---|---|---|---|---|
| 14 - 8 | 0 | 0.0580260 | 0.0238553 | 2.4324168 | 0.1022381 |
| 35 - 8 | 0 | 0.0496097 | 0.0234220 | 2.1180799 | 0.2048812 |
| 56 - 8 | 0 | -0.9048518 | 0.0263517 | -34.3375031 | 0.0000000 |
| 79 - 8 | 0 | -0.8712047 | 0.0261967 | -33.2562726 | 0.0000000 |
| 35 - 14 | 0 | -0.0084163 | 0.0148730 | -0.5658789 | 0.9790782 |
| 56 - 14 | 0 | -0.9628779 | 0.0191580 | -50.2598354 | 0.0000000 |
| 79 - 14 | 0 | -0.9292308 | 0.0189442 | -49.0508684 | 0.0000000 |
| 56 - 35 | 0 | -0.9544615 | 0.0186157 | -51.2718574 | 0.0000000 |
| 79 - 35 | 0 | -0.9208144 | 0.0183956 | -50.0561584 | 0.0000000 |
| 79 - 56 | 0 | 0.0336471 | 0.0220050 | 1.5290662 | 0.5334147 |
#DF.16s %>% ggplot(aes(x = Evenness)) + geom_dotplot() + facet_grid(Day~.)
DF.16s %>% glm(Evenness ~ Day, family = "Gamma", data = .) %>%
glht(linfct = mcp(Day = "Tukey")) %>% summary %>% tidy %>% kable
| lhs | rhs | estimate | std.error | statistic | p.value |
|---|---|---|---|---|---|
| 14 - 8 | 0 | -7.349184 | 7.446101 | -0.9869842 | 0.8514081 |
| 35 - 8 | 0 | -2.531112 | 7.478138 | -0.3384683 | 0.9969147 |
| 56 - 8 | 0 | 39.031788 | 9.087211 | 4.2952441 | 0.0001886 |
| 79 - 8 | 0 | -10.341520 | 7.231208 | -1.4301235 | 0.5890067 |
| 35 - 14 | 0 | 4.818072 | 4.344185 | 1.1090853 | 0.7889456 |
| 56 - 14 | 0 | 46.380972 | 6.747354 | 6.8739496 | 0.0000000 |
| 79 - 14 | 0 | -2.992336 | 3.903813 | -0.7665162 | 0.9353546 |
| 56 - 35 | 0 | 41.562900 | 6.782693 | 6.1277877 | 0.0000000 |
| 79 - 35 | 0 | -7.810408 | 3.964579 | -1.9700472 | 0.2633858 |
| 79 - 56 | 0 | -49.373308 | 6.509434 | -7.5848850 | 0.0000000 |
# overall median evenness
DF.16s %>% summarize(medRich = median(Richness), medEven = median(Evenness))
## medRich medEven
## 1 401 0.02129823
# Simple means
DF.18s %>% group_by(Day) %>% summarize(meanRich = mean(Richness), meanEven = mean(Evenness))
## # A tibble: 5 x 3
## Day meanRich meanEven
## <fctr> <dbl> <dbl>
## 1 8 372.7500 0.04606889
## 2 14 401.1176 0.03790562
## 3 35 384.1053 0.04112068
## 4 56 180.8824 0.02946733
## 5 79 227.0000 0.03412773
227.0000 / 372.7500 # fraction of OTUs remaining on day 79 (vs day 8)
## [1] 0.6089873
1 - 227.0000 / 372.7500 # fraction of OTUs lost on day 79 (vs day 8)
## [1] 0.3910127
#DF.18s %>% ggplot(aes(x = Richness)) + geom_dotplot() + facet_grid(Day~.)
DF.18s %>% glm(Richness ~ Day, family = "poisson", data = .) %>%
glht(linfct = mcp(Day = "Tukey")) %>% summary %>% tidy %>% kable
## Warning in RET$pfunction("adjusted", ...): Completion with error > abseps
| lhs | rhs | estimate | std.error | statistic | p.value |
|---|---|---|---|---|---|
| 14 - 8 | 0 | 0.0733468 | 0.0285891 | 2.565550 | 0.0728817 |
| 35 - 8 | 0 | 0.0300087 | 0.0284203 | 1.055890 | 0.8222335 |
| 56 - 8 | 0 | -0.7230611 | 0.0315577 | -22.912316 | 0.0000000 |
| 79 - 8 | 0 | -0.4959579 | 0.0317735 | -15.609165 | 0.0000000 |
| 35 - 14 | 0 | -0.0433381 | 0.0168426 | -2.573133 | 0.0719422 |
| 56 - 14 | 0 | -0.7964079 | 0.0217221 | -36.663413 | 0.0000000 |
| 79 - 14 | 0 | -0.5693048 | 0.0220344 | -25.837059 | 0.0000000 |
| 56 - 35 | 0 | -0.7530698 | 0.0214994 | -35.027446 | 0.0000000 |
| 79 - 35 | 0 | -0.5259666 | 0.0218149 | -24.110440 | 0.0000000 |
| 79 - 56 | 0 | 0.2271032 | 0.0257695 | 8.812852 | 0.0000000 |
#DF.18s %>% ggplot(aes(x = Evenness)) + geom_dotplot() + facet_grid(Day~.)
DF.18s %>% glm(Evenness ~ Day, family = "Gamma", data = .) %>%
glht(linfct = mcp(Day = "Tukey")) %>% summary %>% tidy %>% kable
| lhs | rhs | estimate | std.error | statistic | p.value |
|---|---|---|---|---|---|
| 14 - 8 | 0 | 4.674688 | 5.392739 | 0.8668486 | 0.9064718 |
| 35 - 8 | 0 | 2.612038 | 5.223468 | 0.5000583 | 0.9869595 |
| 56 - 8 | 0 | 12.229263 | 5.830399 | 2.0975004 | 0.2153959 |
| 79 - 8 | 0 | 7.595065 | 5.803650 | 1.3086703 | 0.6794015 |
| 35 - 14 | 0 | -2.062650 | 3.633544 | -0.5676689 | 0.9790577 |
| 56 - 14 | 0 | 7.554575 | 4.462239 | 1.6930011 | 0.4306853 |
| 79 - 14 | 0 | 2.920376 | 4.427232 | 0.6596393 | 0.9637681 |
| 56 - 35 | 0 | 9.617225 | 4.256119 | 2.2596229 | 0.1537886 |
| 79 - 35 | 0 | 4.983026 | 4.219403 | 1.1809790 | 0.7569154 |
| 79 - 56 | 0 | -4.634199 | 4.950989 | -0.9360147 | 0.8797386 |
# overall median evenness
DF.18s %>% summarize(medRich = median(Richness), medEven = median(Evenness))
## medRich medEven
## 1 286 0.03237989
There will be a matching set of relative abundance plots, for each amplicon type.
Area plot at Phylum level of most common taxa. Samples merged by day.
Rank abundance curve of common genera in day 8 and day 79. This will show variance of the separate genera and help visualize the selection threshold for defining a ‘founders species.’
Line plot of selected genera above that threshold, highlighting ‘founders species.’ It will not show variance of each genera; variance is already shown on 2. and additional information would muddy the graph.
When initially proposed, we called 2. a ‘scree plot.’ We now use the more accurate term ‘rank abundance curve.’ (A scree plots is a rank abundance curve used to show the decreasing eigenvalues of an ordinations.) While our documentation uses the correct term, ‘scree’ is still used in the code.
# Merge by day
cohort.merged <- merge_samples(rar.16s.cohort, "Day")
# Fix mangled metadata
sample_data(cohort.merged)$Day <- as.numeric(sample_names(cohort.merged))
# Glom OTUs by Phyla and transform to RA
glom <- tax_glom(cohort.merged, taxrank = "Rank2")
glom <- transform_sample_counts(glom, function(x) x / sum(x))
prune_taxa(names(sort(taxa_sums(glom), TRUE))[0:11], glom) %>% psmelt() %>%
group_by(OTU, Rank2) %>% summarize(mean = mean(Abundance)) %>% arrange(-mean) %>%
kable()
| OTU | Rank2 | mean |
|---|---|---|
| OTU_4 | D_1__Proteobacteria | 0.4806892 |
| OTU_5 | D_1__Cyanobacteria | 0.3220583 |
| OTU_9 | D_1__Bacteroidetes | 0.0841774 |
| OTU_31 | D_1__Actinobacteria | 0.0298159 |
| OTU_12 | D_1__Planctomycetes | 0.0253331 |
| OTU_36 | D_1__Firmicutes | 0.0176987 |
| OTU_21 | D_1__Chloroflexi | 0.0128887 |
| OTU_37 | D_1__Spirochaetes | 0.0117361 |
| OTU_50 | D_1__Verrucomicrobia | 0.0041929 |
| OTU_42 | D_1__Chlamydiae | 0.0026787 |
| OTU_90 | D_1__Patescibacteria | 0.0020768 |
# Select top Phyla
glom.top <- prune_taxa(names(sort(taxa_sums(glom), TRUE))[0:7], glom)
sum(taxa_sums(glom.top)) / sum(taxa_sums(glom))
## [1] 0.9726613
# Melt for graphing and strip prefix
glom.top.melt <- psmelt(glom.top)
glom.top.melt <- arrange(glom.top.melt, Day, Rank2)
glom.top.melt$Phylum <- gsub('D_1__', '', glom.top.melt$Rank2)
# Graph
glom.top.gg <- ggplot(glom.top.melt, aes(x = as.numeric(Day), y = Abundance, fill = Phylum))
part1 <- glom.top.gg + geom_area() +
v.fill +
labs(fill = "Bacteria", y = "Abundance") +
theme(plot.margin=unit(c(5,5,-25,5), units = "pt"), legend.justification = 'left') +
scale_x_continuous("Sampling Day", c(8,14,35,56,79), NULL)
part1
# Merge by day
cohort.merged18s <- merge_samples(rar.18s.cohort, "Day")
# Fix mangled metadata
sample_data(cohort.merged18s)$Day <- as.numeric(sample_names(cohort.merged18s))
# Glom OTUs by Phyla and transform to RA
glom.18s <- tax_glom(cohort.merged18s, taxrank = "Rank3")
glom.18s <- transform_sample_counts(glom.18s, function(x) x / sum(x))
prune_taxa(names(sort(taxa_sums(glom.18s), TRUE))[0:11], glom.18s) %>% psmelt() %>%
group_by(OTU, Rank2, Rank3) %>% summarize(mean = mean(Abundance)) %>% arrange(-mean) %>%
kable()
| OTU | Rank2 | Rank3 | mean |
|---|---|---|---|
| OTU_1 | D_1__Proteobacteria | D_2__Alphaproteobacteria | 0.3659231 |
| OTU_2 | D_1__SAR | D_2__Stramenopiles | 0.3628062 |
| OTU_8 | D_1__Planctomycetes | D_2__Planctomycetacia | 0.0583160 |
| OTU_12 | D_1__Opisthokonta | D_2__Holozoa | 0.0548644 |
| OTU_24 | D_1__Proteobacteria | D_2__Gammaproteobacteria | 0.0445087 |
| OTU_6 | D_1__SAR | D_2__Rhizaria | 0.0417013 |
| OTU_7 | D_1__Proteobacteria | D_2__Deltaproteobacteria | 0.0315509 |
| OTU_16 | D_1__Planctomycetes | D_2__Phycisphaerae | 0.0197343 |
| OTU_32 | D_1__Verrucomicrobia | D_2__Verrucomicrobiae | 0.0069975 |
| OTU_63 | D_1__SAR | D_2__Alveolata | 0.0031580 |
| OTU_64 | D_1__Archaeplastida | D_2__Chloroplastida | 0.0023622 |
# Select top Phyla
glom.18s.top <- prune_taxa(names(sort(taxa_sums(glom.18s), TRUE))[0:7], glom.18s)
sum(taxa_sums(glom.18s.top)) / sum(taxa_sums(glom.18s))
## [1] 0.9596707
# Melt for graphing and strip prefix
glom.18s.top.melt <- psmelt(glom.18s.top)
glom.18s.top.melt <- arrange(glom.18s.top.melt, Day, Rank3)
glom.18s.top.melt$Phylum <- gsub('D_.__', '', glom.18s.top.melt$Rank3)
glom.18s.top.melt$Phylum <- gsub('D_..__', '', glom.18s.top.melt$Phylum)
# Graph
glom.18s.top.gg <- ggplot(glom.18s.top.melt, aes(x = as.numeric(Day), y = Abundance, fill = Phylum))
part1.18s.Rank3 <- glom.18s.top.gg + geom_area() +
pl.fill +
labs(fill="Eukaryotes", y = "Abundance") +
theme(plot.margin=unit(c(0,5,5,5), units = "pt"), legend.justification = 'left') +
scale_x_continuous("Sampling Day", c(8,14,35,56,79), NULL)
part1.18s.Rank3
# Merge by day
cohort.merged18s <- merge_samples(rar.18s.cohort, "Day")
# Fix mangled metadata
sample_data(cohort.merged18s)$Day <- as.numeric(sample_names(cohort.merged18s))
# Glom OTUs by Phyla and transform to RA
glom.18s <- tax_glom(cohort.merged18s, taxrank = "Rank2")
glom.18s <- transform_sample_counts(glom.18s, function(x) x / sum(x))
prune_taxa(names(sort(taxa_sums(glom.18s), TRUE))[0:11], glom.18s) %>% psmelt() %>%
group_by(OTU, Rank2) %>% summarize(total = sum(Abundance)) %>% arrange(-total) %>%
kable()
| OTU | Rank2 | total |
|---|---|---|
| OTU_1 | D_1__Proteobacteria | 2.2099138 |
| OTU_2 | D_1__SAR | 2.0383274 |
| OTU_8 | D_1__Planctomycetes | 0.3906686 |
| OTU_12 | D_1__Opisthokonta | 0.2767001 |
| OTU_32 | D_1__Verrucomicrobia | 0.0349875 |
| OTU_64 | D_1__Archaeplastida | 0.0118111 |
| OTU_84 | D_1__Firmicutes | 0.0106303 |
| OTU_122 | D_1__Amoebozoa | 0.0089289 |
| OTU_92 | D_1__Nanoarchaeaeota | 0.0041491 |
| OTU_111 | D_1__Kiritimatiellaeota | 0.0035591 |
| OTU_117 | D_1__Excavata | 0.0029298 |
# Select top Phyla
glom.18s.top <- prune_taxa(names(sort(taxa_sums(glom.18s), TRUE))[0:7], glom.18s)
sum(taxa_sums(glom.18s.top)) / sum(taxa_sums(glom.18s))
## [1] 0.9946078
# Melt for graphing and strip prefix
glom.18s.top.melt <- psmelt(glom.18s.top)
glom.18s.top.melt <- arrange(glom.18s.top.melt, Day, Rank2)
glom.18s.top.melt$Phylum <- gsub('D_.__', '', glom.18s.top.melt$Rank2)
glom.18s.top.melt$Phylum <- gsub('D_..__', '', glom.18s.top.melt$Phylum)
# Graph
glom.18s.top.gg <- ggplot(glom.18s.top.melt, aes(x = as.numeric(Day), y = Abundance, fill = Phylum))
part1.18s.Rank2 <- glom.18s.top.gg + geom_area() +
pl.fill +
labs(fill="Eukaryotes", y = "Abundance") +
theme(plot.margin=unit(c(0,5,5,5), units = "pt"), legend.justification = 'left') +
scale_x_continuous("Sampling Day", c(8,14,35,56,79), NULL)
part1.18s.Rank2
phylum.both.rank3 <- plot_grid(part1, part1.18s.Rank3, rel_heights = c(1,1.2),
#labels = c("A", "B"),
align = "v", nrow = 2)
phylum.both.rank3
ggsave("./figures/phylum.both.Rank3.pdf", phylum.both.rank3, scale = 1.3, width = 89, height = 89, units = "mm")
phylum.both.rank2 <- plot_grid(part1, part1.18s.Rank2, rel_heights = c(1,1.2),
#labels = c("A", "B"),
align = "v", nrow = 2)
phylum.both.rank2
ggsave("./figures/phylum.both.Rank2.pdf", phylum.both.rank2, scale = 1.3, width = 89, height = 89, units = "mm")
# combined.fig1 <-
# plot_grid(alpha.both.alt, phylum.both, labels = c("A", "B"),
# align = "h", nrow = 1, rel_widths = c(1.1, 1), scale = c(1,1))
# ggsave("./figures/fig1.pdf", combined.fig1, scale = 1.4, width = 178, height = 77, units = "mm")
#
# combined.wide.fig1 <-
# plot_grid(alpha.both.alt, phylum.both, labels = c("A", "B"),
# align = "v", ncol = 1, rel_heights = c(1, 1.2), scale = c(1,1))
# ggsave("./figures/fig1-wide.pdf", combined.wide.fig1, scale = 1.3, width = 89, height = 160, units = "mm")
#
# new all silva graphs
combined.tall.fig1.Rank2 <-
plot_grid(alpha.both.alt, phylum.both.rank2, labels = c("A", "B"),
align = "v", ncol = 1, rel_heights = c(1, 1.2), scale = c(1,1))
ggsave("./figures/fig1-tall-Rank2.pdf", combined.tall.fig1.Rank2, scale = 1.3, width = 89, height = 160, units = "mm")
combined.tall.fig1.Rank3 <-
plot_grid(alpha.both.alt, phylum.both.rank3, labels = c("A", "B"),
align = "v", ncol = 1, rel_heights = c(1, 1.2), scale = c(1,1))
ggsave("./figures/fig1-tall-Rank3.pdf", combined.tall.fig1.Rank3, scale = 1.3, width = 89, height = 160, units = "mm")
#Save and exit.
knitr::knit_exit()
These functions are specific to this data set and are not intended for general use.
clean_gg_tax() strip GreenGenes prefixes from taxonomy strings.
clean_silva_tax() strip SILVA prefixes from taxonomy strings.
aggregate_tax_by_day() aggregate(Abundance ~ Day + Taxonomy) and add stats used for box plots.
clean_gg_tax <- function(pmelted){
pmelted$Taxonomy <- paste(pmelted$Rank4,
pmelted$Rank5,
pmelted$Rank6, sep = ", ")
pmelted$Taxonomy <- gsub('.__', '', pmelted$Taxonomy)
pmelted$Taxonomy <- gsub(' ,', '', pmelted$Taxonomy)
pmelted$Kingdom <- gsub('.__', '', pmelted$Rank1)
pmelted$Phylum <- gsub('.__', '', pmelted$Rank2)
pmelted$Class <- gsub('.__', '', pmelted$Rank3)
pmelted$Order <- gsub('.__', '', pmelted$Rank4)
pmelted$Family <- gsub('.__', '', pmelted$Rank5)
pmelted$Genus <- gsub('.__', '', pmelted$Rank6)
return(pmelted)
}
clean_silva_tax <- function(pmelted){
pmelted$Taxonomy <- paste(pmelted$Rank4,
pmelted$Rank5,
pmelted$Rank6, sep = ", ")
pmelted$Taxonomy <- gsub('D_.__', '', pmelted$Taxonomy)
pmelted$Taxonomy <- gsub('D_..__', '', pmelted$Taxonomy)
pmelted$Taxonomy <- gsub(' ,', '', pmelted$Taxonomy)
pmelted$Kingdom <- gsub('D_.__', '', pmelted$Rank1) #D_0
pmelted$Phylum <- gsub('D_.__', '', pmelted$Rank2) #D_1
pmelted$Class <- gsub('D_.__', '', pmelted$Rank3) #D_2
pmelted$Order <- gsub('D_.__', '', pmelted$Rank4) #D_3
pmelted$Family <- gsub('D_.__', '', pmelted$Rank5) #D_4
pmelted$Genus <- gsub('D_.__', '', pmelted$Rank6) #D_5
if("Rank7" %in% names(pmelted)){
pmelted$Species <- gsub('D_.__', '', pmelted$Rank7) #D_6
}
return(pmelted)
}
aggregate_tax_by_day <- function(pmelted){
# Calculate median of the Abundance for each taxa at each day
paggregated <- aggregate(Abundance ~ OTU + Day + Taxonomy,
data = pmelted,
FUN = function(x) median(x))
return(paggregated)
}
aggregate_tax_by_day_n <- function(pmelted){
# Same as above, but also casts Day as numeric
paggregated <- aggregate(Abundance ~ OTU + Day + Taxonomy,
data = pmelted,
FUN = function(x) median(x))
paggregated$Day <- as.numeric(levels(paggregated$Day))[paggregated$Day]
return(paggregated)
}
# Glom OTUs by phyla and transform to RA
glom6.16s <- tax_glom(rar.16s.cohort, taxrank = "Rank6")
glom6.16s <- transform_sample_counts(glom6.16s, function(x) x / sum(x))
glom6.18s <- tax_glom(rar.18s.cohort, taxrank = "Rank6")
glom6.18s <- transform_sample_counts(glom6.18s, function(x) x / sum(x))
glom7.18s <- tax_glom(rar.18s.cohort, taxrank = "Rank7")
glom7.18s <- transform_sample_counts(glom7.18s, function(x) x / sum(x))
selection_threshold <- 0.05
# for a comparison to 0.05, see the file `Compare .02 vs .05.PNG`
# Select top genera from day 8 and 79
glom6.16s.days <- subset_samples(glom6.16s, Day %in% c("8", "79"))
glom6.16s.days.top <- prune_taxa(names(sort(taxa_sums(glom6.16s.days), TRUE))[0:20], glom6.16s.days)
# Melt to dataframe
glom6.16s.days.top.melt <- clean_silva_tax(psmelt(glom6.16s.days.top))
# Sort OTUs by their medians in day 8
glom6.16s.days.top.melt.8 <- subset(glom6.16s.days.top.melt, Day == "8")
reordered_levels <- levels(reorder(glom6.16s.days.top.melt.8$OTU, -(glom6.16s.days.top.melt.8$Abundance), median))[]
glom6.16s.days.top.melt$OTU <- factor(glom6.16s.days.top.melt$OTU, levels = reordered_levels)
levels(glom6.16s.days.top.melt$Day) <- c("Day 8", "Day 79")
# Graph, splitting by day
glom6.16s.days.top.gg <- ggplot(glom6.16s.days.top.melt, aes(x=OTU, y = Abundance))
scree.16s <- glom6.16s.days.top.gg +
geom_hline(yintercept = selection_threshold, size = 1) +
geom_boxplot(aes(color = Phylum)) +
v +
labs(title = "Most Common Bacteria", y = "Abundance") +
facet_grid(~Day) +
#scale_y_continuous(limits = c(-.02, .95)) +
theme(axis.text.x = element_blank(),
axis.title.x = element_blank(),
legend.position = "bottom",
strip.background = element_blank()) +
guides(color=guide_legend(nrow=2,byrow=TRUE))
scree.16s
# Get the medians shown in the graph
glom6.16s.days.top.median <- aggregate_tax_by_day(glom6.16s.days.top.melt)
# Select the genera with medians above the cutoff.
glom6.16s.days.top.median.top <- glom6.16s.days.top.median %>%
filter(Abundance > selection_threshold) %>% arrange(Day, -Abundance)
glom6.16s.days.top.median.top
## OTU Day Taxonomy
## 1 OTU_5 Day 8 Phormidesmiales, Nodosilineaceae, uncultured
## 2 OTU_16 Day 8 Sphingomonadales, Sphingomonadaceae, Erythrobacter
## 3 OTU_17 Day 8 Nostocales, Geitlerinemaceae, Geitlerinema PCC-7105
## 4 OTU_9 Day 79 Balneolales, Balneolaceae, Rhodohalobacter
## 5 OTU_6 Day 79 Oceanospirillales, Saccharospirillaceae, Saccharospirillum
## 6 OTU_18 Day 79 Bradymonadales, Bradymonadaceae, uncultured bacterium
## 7 OTU_5 Day 79 Phormidesmiales, Nodosilineaceae, uncultured
## Abundance
## 1 0.47318313
## 2 0.09406673
## 3 0.05263741
## 4 0.29750263
## 5 0.24477015
## 6 0.11512963
## 7 0.11346903
# Select these OTUs from all days, for use in the line graphs
glom6.16s.all.select_taxa <- prune_taxa(as.character(glom6.16s.days.top.median.top$OTU), glom6.16s)
glom6.16s.all.select_taxa
## phyloseq-class experiment-level object
## otu_table() OTU Table: [ 6 taxa and 71 samples ]
## sample_data() Sample Data: [ 71 samples by 9 sample variables ]
## tax_table() Taxonomy Table: [ 6 taxa by 7 taxonomic ranks ]
## phy_tree() Phylogenetic Tree: [ 6 tips and 5 internal nodes ]
# Select top genera from day 8 and 79
glom.18s.days <- subset_samples(glom6.18s, Day %in% c("8", "79"))
glom.18s.days.top <- prune_taxa(names(sort(taxa_sums(glom.18s.days), TRUE))[0:20], glom.18s.days)
# Melt to dataframe
glom.18s.days.top.melt <- clean_silva_tax(psmelt(glom.18s.days.top))
# Sort OTUs by their medians in day 8
glom.18s.days.top.melt.8 <- subset(glom.18s.days.top.melt, Day == "8")
reordered_levels.18s <- levels(reorder(glom.18s.days.top.melt.8$OTU, -(glom.18s.days.top.melt.8$Abundance), median))[]
glom.18s.days.top.melt$OTU <- factor(glom.18s.days.top.melt$OTU, levels = reordered_levels.18s)
levels(glom.18s.days.top.melt$Day) <- c("Day 8", "Day 79")
# Graph, splitting by day
glom.18s.days.top.gg <- ggplot(glom.18s.days.top.melt, aes(x=OTU, y = Abundance))
scree.18s <- glom.18s.days.top.gg +
geom_hline(yintercept = selection_threshold, size = 1) +
geom_boxplot(aes(color = Phylum)) +
pl +
labs(title = "Most Common Eukaryotes", y = "Abundance") +
facet_grid(~Day) +
scale_y_continuous(breaks = c(.2, .4, .6, .8)) +
theme(axis.text.x=element_blank(),
axis.title.x = element_blank(),
legend.position = "bottom",
strip.background = element_blank()) +
guides(color=guide_legend(nrow=2,byrow=TRUE))
scree.18s
# Get the medians shown in the graph
glom.18s.days.top.median <- aggregate_tax_by_day(glom.18s.days.top.melt)
# Select the genera with medians above the cutoff.
glom.18s.days.top.median.top <- glom.18s.days.top.median %>%
filter(Abundance > selection_threshold) %>% arrange(Day, -Abundance)
glom.18s.days.top.median.top %>% arrange(Day, -Abundance)
## OTU Day Taxonomy
## 1 OTU_14 Day 8 Sphingomonadales, Sphingomonadaceae, Sphingomonas
## 2 OTU_1 Day 8 Rhodobacterales, Rhodobacteraceae, uncultured
## 3 OTU_13 Day 8 Metazoa (Animalia), Podocopa, Podocopida
## 4 OTU_8 Day 8 Pirellulales, Pirellulaceae, Roseimaritima
## 5 OTU_30 Day 8 Ochrophyta, Bacillariophyceae, Pinnularia
## 6 OTU_3 Day 79 Ochrophyta, Bacillariophyceae, Nitzschia
## 7 OTU_1 Day 79 Rhodobacterales, Rhodobacteraceae, uncultured
## 8 OTU_21 Day 79 Rhodobacterales, Rhodobacteraceae, Roseovarius
## Abundance
## 1 0.15091651
## 2 0.11996547
## 3 0.07987672
## 4 0.06748622
## 5 0.05229693
## 6 0.47846172
## 7 0.28137744
## 8 0.05011255
# Select these OTUs from all days, for use in the line graphs
glom.18s.all.select_taxa <- prune_taxa(as.character(glom.18s.days.top.median.top$OTU), glom6.18s)
glom.18s.all.select_taxa
## phyloseq-class experiment-level object
## otu_table() OTU Table: [ 7 taxa and 69 samples ]
## sample_data() Sample Data: [ 69 samples by 9 sample variables ]
## tax_table() Taxonomy Table: [ 7 taxa by 7 taxonomic ranks ]
## phy_tree() Phylogenetic Tree: [ 7 tips and 6 internal nodes ]
plot_grid(scree.16s, scree.18s, labels = c("A", "B"), ncol = 2, align = "h")
Let’s evaluate what proportion of the overall community is captured by the most common genera we are showing here.
sum(sample_sums(glom6.16s.all.select_taxa))/sum(sample_sums(glom6.16s))
## [1] 0.7500129
sum(sample_sums(glom.18s.all.select_taxa))/sum(sample_sums(glom.18s))
## [1] 0.9001903
Note that we intentionally replace these taxonomies with more useful annotations.
# Graph this: glom6.16s.all.select_taxa
select.16s.melt <- clean_silva_tax(psmelt(glom6.16s.all.select_taxa))
#head(select.16s.melt)
# Aggregate for graphing
select.16s.median <- aggregate_tax_by_day_n(select.16s.melt)
# Add category for the founders species
select.16s.median.founders <- select.16s.median[select.16s.median$Abundance > selection_threshold & select.16s.median$Day == "8", ]
select.16s.median$`Founders Species` <- select.16s.median$OTU %in% select.16s.median.founders$`OTU`
select.16s.median$`Founders Species` <- factor(select.16s.median$`Founders Species`,
levels = c("TRUE", "FALSE"),
labels = c("Founders Species", "Other Common Genera"))
# replace taxa names
#select.16s.median$Taxonomy[select.16s.median$Taxonomy == "GMD14H09, "] <- "Deltaproteobacteria, GMD14H09"
select.16s.gg <- ggplot(select.16s.median, aes(x = Day, y = Abundance))
#select.16s.gg + geom_bar(aes(fill = Taxonomy), color = 'black', stat = 'identity')
selected.16s.line <- select.16s.gg +
geom_line(aes(color = Taxonomy, linetype=`Founders Species`)) +
geom_point(aes(color = Taxonomy)) + v +
scale_linetype(name="", guide = T) +
scale_x_continuous("Sampling Day", c(8,14,35,56,79), NULL) +
theme(legend.spacing = unit(-0.5, "cm"), legend.background = element_blank()) +
# #This next line is a kludge. I manually dash the legend lines to show which ones are FS.
#guides(color=guide_legend(override.aes=list(linetype=c(2,2,2,1,1,1,2,1), shape = c(NA))))
guides(color=guide_legend(override.aes=list(linetype=c(2,2,1,2,1,1), shape = c(NA)), order = 1)
,linetype = guide_legend(override.aes=list(linetype=c(1,2)), order = 2)
)
# 2 is dashed, 1 is solid
selected.16s.line
# Table of species
select.16s.median %>% dplyr::select(Taxonomy, `Founders Species`) %>% unique %>% kable
| Taxonomy | Founders Species | |
|---|---|---|
| 1 | Balneolales, Balneolaceae, Rhodohalobacter | Other Common Genera |
| 6 | Bradymonadales, Bradymonadaceae, uncultured bacterium | Other Common Genera |
| 11 | Nostocales, Geitlerinemaceae, Geitlerinema PCC-7105 | Founders Species |
| 16 | Oceanospirillales, Saccharospirillaceae, Saccharospirillum | Other Common Genera |
| 21 | Phormidesmiales, Nodosilineaceae, uncultured | Founders Species |
| 26 | Sphingomonadales, Sphingomonadaceae, Erythrobacter | Founders Species |
# Graph this: glom6.16s.all.select_taxa
select.18s.melt <- clean_silva_tax(psmelt(glom.18s.all.select_taxa))
#head(select.18s.melt)
# Aggregate for graphing
select.18s.median <- aggregate_tax_by_day_n(select.18s.melt)
# Add category for the founders species
select.18s.median.founders <- select.18s.median[select.18s.median$Abundance > selection_threshold & select.18s.median$Day == "8", ]
select.18s.median$`Founders Species` <- select.18s.median$OTU %in% select.18s.median.founders$`OTU`
select.18s.median$`Founders Species` <- factor(select.18s.median$`Founders Species`,
levels = c("TRUE", "FALSE"),
labels = c("Founders Species", "Other Common Genera"))
select.18s.gg <- ggplot(select.18s.median, aes(x = Day, y = Abundance))
#select.18s.gg + geom_bar(aes(fill = Taxonomy), color = 'black', stat = 'identity')
select.18s.line <- select.18s.gg +
geom_line(aes(color = Taxonomy, linetype=`Founders Species`)) +
geom_point(aes(color = Taxonomy)) + pl +
scale_linetype(name= element_blank(), guide = F) +
scale_x_continuous("Sampling Day", c(8,14,35,56,79), NULL) +
theme(legend.spacing = unit(-0.5, "cm"), legend.background = element_blank()) +
# #This next line is a kludge. I manually dash the legend lines to show which ones are FS.
# guides(color = guide_legend(override.aes=list(linetype=c(1,1,1,1,2,2,1), shape = c(NA)), order = 1)
guides(color = guide_legend(override.aes=list(linetype=c(1,2,1, 1,2,1,1), shape = c(NA)), order = 1)
)
select.18s.line
# Table of species
select.18s.median %>% dplyr::select(Taxonomy, `Founders Species`) %>% unique %>% kable(row.names = F)
| Taxonomy | Founders Species |
|---|---|
| Metazoa (Animalia), Podocopa, Podocopida | Founders Species |
| Ochrophyta, Bacillariophyceae, Nitzschia | Other Common Genera |
| Ochrophyta, Bacillariophyceae, Pinnularia | Founders Species |
| Pirellulales, Pirellulaceae, Roseimaritima | Founders Species |
| Rhodobacterales, Rhodobacteraceae, Roseovarius | Other Common Genera |
| Rhodobacterales, Rhodobacteraceae, uncultured | Founders Species |
| Sphingomonadales, Sphingomonadaceae, Sphingomonas | Founders Species |
scree.line.both.alt <- plot_grid(rel_heights = c(1, 1.1),
labels = c("A", "B", "C", "D"),
scree.16s + theme(legend.position = "right") + guides(color=guide_legend(byrow=F)),
scree.18s + theme(legend.position = "right") + guides(color=guide_legend(byrow=F)),
selected.16s.line,
select.18s.line)
#scree.line.both.alt
ggsave("./figures/scree_and_line_silva.pdf", scree.line.both.alt, scale = 1.6, width = 183, height = 82, units = "mm")
glom6.16s.all.select_taxa %>% tax_table()
# Look at OTU_18 (o__GMD14H09) and OTU_574 (o__Stramenopiles)
# ¿Qué es un o__GMD14H09?
inspect.o__GMD14H09 <- full16s %>%
merge_samples(group = "SampleType") %>%
psmelt() %>% filter(Rank4 == "o__GMD14H09")
inspect.o__GMD14H09 %>% head
# This family is mostly OTU_18
"
>OTU_18
TACGGAGGGTGCAAGCGTTGTTCGGAATCATTGGGCGTAAAGGGCGCGCAGGCGGTCTTTCAAGTCCGGCGTGAAATCCC
AGGGCTCAACCCTGGAACTGCGTTGGAAACTGGACGACTTGAGTATGGGAGAGGTTCGTGGAATTCCAGGTGTAGGGGTG
AAATCCGTAGATATCTGGAGGAACACCGGCGGCGAAAGCGACGAACTGGACCAACACTGACGCTGAGGCGCGAAAGCGTG
GGGAGCAAACA
"
# Silva: 88.9% Bacteria;Proteobacteria;Deltaproteobacteria;Bradymonadales;
# (Silva also has one hit to Desulfuromonadales)
# NCBI Megablast: Many hits at 86% that match to
# Bacteria; Proteobacteria; Deltaproteobacteria; Desulfuromonadales
# Stranger Stramenopiles:
# NOTE: When we removed c__Chloroplasts, we got rid of o__Stramenopiles.
# But we can still get them from full16s
inspect.o__Stramenopiles <- full16s %>%
merge_samples(group = "SampleType") %>%
psmelt() %>% filter(Rank4 == "o__Stramenopiles")
inspect.o__Stramenopiles %>% head
# Many OTUs, including OTU_1 are inside this order. I'm wondering if these are
# just different chloroplasts...
"
>OTU_574
GACGGAGGATGCAAGTGTTATCCGGAATCACTGGGCGTAAAGCGTCTGTAGGTGGTTTAATAAGTCAACTGTTAAATCTT
GAAGCTCAACTTCAAAATCGCAGTCGAAACTATTAGACTAGAGTATAGTAGGGGTAAAGGGAATTTCCAGTGGAGCGGTG
AAATGCGTAGAGATTGGAAAGAACACCGATGGCGAAGGCACTTTACTGGGCTATTACTGACACTCAGAGACGAAAGTGTG
GGGAGCAAACA
>OTU_148
GACGGAGGATGCAAGTGTTATCCGGAATCACTGGGCGTAAAGCGTCTGTAGGTGGTTTAATAAGTCAACTGTTAAATCTT
GAGGCTCAACCTCAAAATCGCAGTCGAAACTATTAGACTAGAGTATAGTAGGGGTAAAGGGAATTTCCAGTGGAGCGGTG
AAATGCGTAGATATTGGAAGGAACACCGATGGCGAAGGCACTTTACTGGGCTATTTATTACTAACACTCAGAGACGAAAG
CTAGGGTAGCA
>OTU_1
GACGGAGGATGCAAGTGTTATCCGGAATCACTGGGCGTAAAGCGTCTGTAGGTGGTTTAGTAAGTCAACTGTTAAATCTT
GAAGCTCAACTTCAAAACCGCAGTCGAAACTATTAGACTAGAGTATAGTAGGGGTAAAGGGAATTTCCAGTGGAGCGGTG
AAATGCGTAGAGATTGGAAAGAACACCGATGGCGAAGGCACTTTACTGGGCTATTACTGACACTCAGAGACGAAAGCTAG
GGTAGCAAATG
"
# Silva: All hits 97% - 99% Bacteria;Cyanobacteria;Chloroplast;
# ... Yep. Totally Chloroplasts.
# Lake Tomatoes:
# More searches with SILVA will help us understand if
# "Charophyta, Solanales, Solanum" is really a Lake Tomato
# https://en.wikipedia.org/wiki/Solanum
# You say potato, I say over-identification. Let's find that taxa in our original, full data set.
full18s %>%
subset_taxa(Rank4 == "D_3__Charophyta") %>%
plot_bar(fill = "Rank7", title = "Lake Tomatoes of Unusual Size")
# Our 'tomatoes' are flourishing. But what is their amplicon sequence?
full18s %>% merge_samples(group = "SampleType") %>%
subset_taxa(Rank7 == "D_12__Solanum lycopersicum (tomato)") %>% psmelt %>% head
# grep for OTU_16, 45 and 46
"
>OTU_16
AAGTCATGGAAGCTGGCAGCGCCCGAAGTCGCCTCGAATCAGGGGTGCCCACGGTGAGGCTGGTGACTGGGACTAAGTCG
TAACAAGGTAGCC
>OTU_45
ACACCATGGGAGTTGGCTTTACCCGAAGCCGGTGCGCTAACCGCAAGGAGGCAGCCGTCCACGGTAAGGTCAGCGACTGG
GGTGAAGTCGTAACAAGGTAGCC
>OTU_46
ACACCATGGGAGTTGGCTCTACCCGAAGACGCTGTGCTAACCGCAAGGGGGCAGGCGGCCACGGTAGGGTCAGCGACTGG
GGTGAAGTCGTAACAAGGTAGCC
"
# 45 and 46 are similar, while 16 is much shorter from a deletion in the first half.
# My taxonomy annotation was based on a search of SILVA 18S, and returned hits
# around 70%. A quick search of the 16S gene in SILVA returns hits above 94%
# and a LCA tax of:
# OTU_16 Bacteria;Planctomycetes;Phycisphaerae;Phycisphaerales;Phycisphaeraceae;
# OTU_45 Bacteria;Proteobacteria;Alphaproteobacteria;
# OTU_46 Bacteria;Proteobacteria;Alphaproteobacteria;Alphaproteobacteria Incertae Sedis;Unknown Family;
# Given that we see some Planctomycetes lots Proteobacteria of, these are
# probably off-target effects of the 18S primers, and not lake tomatoes after all.
Here we make use of the methods implemented in the betapart and picante package and described in this paper by James Stegen.
https://cran.r-project.org/web/packages/betapart/betapart.pdf https://github.com/skembel/picante
The these packages don’t like the phyloseq:: data structures. So let’s export phyloseq objects in a picante friendly way.
# This function does not export the taxonomy table
# and does not include a trait table.
setClass("ps.pic", representation(phy = "phylo", otu = "matrix"))
phyloseq_to_picante <- function(psobject){
if(class(psobject) != "phyloseq") stop("Input must be a phyloseq object")
return(new("ps.pic", phy = psobject@phy_tree,
otu = if(psobject@otu_table@taxa_are_rows) t(psobject@otu_table) else psobject@otu_table
)
)
}
# This must be the worst S4 class ever constructed.
# phyloseq_to_picante(glom.18s)@phy
# phyloseq_to_picante(glom.18s)@otu %>% head
# phyloseq_to_picante(glom.18s)@otu %>% class
Any differences between two samples can explained by either the loss of a shared species or the introduction of a unique species. (Beta diversity can be partitions into Nestedness and Turnover.)
See betapart: an R package for the study of beta diversity and the vignette (PDF).
# Export to picante
# use full cohort...
# rar.16s.cohort.ex <- rar.16s.cohort %>% phyloseq_to_picante
# or remove otus that never appear...
# rar.16s.cohort.ex <- rar.16s.cohort %>% filter_taxa(flist = function(x) max(x) > 0, prune = T) %>% phyloseq_to_picante # 2373 taxa
# or remove singletons.
rar.16s.cohort.ex <- rar.16s.cohort %>% filter_taxa(flist = function(x) sum(x) > 1, prune = T) %>% phyloseq_to_picante
rar.18s.cohort.ex <- rar.18s.cohort %>% filter_taxa(flist = function(x) sum(x) > 1, prune = T) %>% phyloseq_to_picante
# Convert to binary
rar.16s.cohort.ex.b <- rar.16s.cohort.ex
rar.16s.cohort.ex.b@otu[rar.16s.cohort.ex.b@otu > 0] = 1
rar.18s.cohort.ex.b <- rar.18s.cohort.ex
rar.18s.cohort.ex.b@otu[rar.18s.cohort.ex.b@otu > 0] = 1
# merge both data sets
# copy OTU table
rar.both.ex <- rar.18s.cohort.ex.b@otu
# rename OTUs
taxa_names(rar.both.ex) <- rar.both.ex %>% taxa_names() %>% paste("18s", sep = "_")
# merge, and save
rar.both.ex <- merge_phyloseq_pair(rar.both.ex, rar.16s.cohort.ex.b@otu)
rar.16s.cohort.ex.j <- beta.pair(rar.16s.cohort.ex.b@otu, index.family = "jaccard")
rar.18s.cohort.ex.j <- beta.pair(rar.18s.cohort.ex.b@otu, index.family = "jaccard")
rar.both.ex.j <- beta.pair(rar.both.ex, index.family = "jaccard")
# $ beta.jtu is turnover, beta.jne is nestedness, beta.jac is combined Jaccard
#rar.16s.cohort.ex.j$beta.jtu
distmelt <- function(d){
d.melt <- d %>% as.matrix %>% as.data.frame %>% tibble::rownames_to_column() %>% melt()
d.melt$variable <- as.character(d.melt$variable)
return(d.melt[d.melt$variable > d.melt$rowname, ])
}
jaccard.melt <- rar.16s.cohort.ex.j$beta.jac %>% distmelt()
## Using rowname as id variables
turnover.melt <- rar.16s.cohort.ex.j$beta.jtu %>% distmelt()
## Using rowname as id variables
nestedness.melt <- rar.16s.cohort.ex.j$beta.jne %>% distmelt()
## Using rowname as id variables
jaccard.melt.18s <- rar.18s.cohort.ex.j$beta.jac %>% distmelt()
## Using rowname as id variables
turnover.melt.18s <- rar.18s.cohort.ex.j$beta.jtu %>% distmelt()
## Using rowname as id variables
nestedness.melt.18s <- rar.18s.cohort.ex.j$beta.jne %>% distmelt()
## Using rowname as id variables
jaccard.melt.both <- rar.both.ex.j$beta.jac %>% distmelt()
## Using rowname as id variables
turnover.melt.both <- rar.both.ex.j$beta.jtu %>% distmelt()
## Using rowname as id variables
nestedness.melt.both <- rar.both.ex.j$beta.jne %>% distmelt()
## Using rowname as id variables
# 16S
# jaccard.melt %>% ggplot(aes(y = variable, x = rowname, fill = value)) + geom_raster()
# turnover.melt %>% ggplot(aes(y = variable, x = rowname, fill = value)) + geom_raster()
# nestedness.melt %>% ggplot(aes(y = variable, x = rowname, fill = value)) + geom_raster()
# 18S
# jaccard.melt.18s %>% ggplot(aes(y = variable, x = rowname, fill = value)) + geom_raster()
# turnover.melt.18s %>% ggplot(aes(y = variable, x = rowname, fill = value)) + geom_raster()
# nestedness.melt.18s %>% ggplot(aes(y = variable, x = rowname, fill = value)) + geom_raster()
# Merge for combined graph
jaccard.melt$Type <- "Total"
turnover.melt$Type <- "Turnover"
nestedness.melt$Type <- "Nestedness"
all.melt <- rbind(jaccard.melt, turnover.melt, nestedness.melt)
jaccard.melt.18s$Type <- "Total"
turnover.melt.18s$Type <- "Turnover"
nestedness.melt.18s$Type <- "Nestedness"
all.melt.18s <- rbind(jaccard.melt.18s, turnover.melt.18s, nestedness.melt.18s)
jaccard.melt.both$Type <- "Total"
turnover.melt.both$Type <- "Turnover"
nestedness.melt.both$Type <- "Nestedness"
all.melt.both <- rbind(jaccard.melt.both, turnover.melt.both, nestedness.melt.both)
# Add columns listing the categories that the samples are in. Match them using grep.
fix_rows <- function(df){
try(
# try() to add nice labels, but don't mentioned it if there is no $Type
df$Type <- factor(df$Type, levels = c("Total", "Nestedness", "Turnover")), silent = T
)
df$row_cat <- 1
df$row_cat[grepl("T2", df$rowname, fixed = T)] <- 8
df$row_cat[grepl("T3", df$rowname, fixed = T)] <- 14
df$row_cat[grepl("T4", df$rowname, fixed = T)] <- 35
df$row_cat[grepl("T5", df$rowname, fixed = T)] <- 56
df$row_cat[grepl("T6", df$rowname, fixed = T)] <- 79
df$var_cat <- 1
df$var_cat[grepl("T2", df$variable, fixed = T)] <- 8
df$var_cat[grepl("T3", df$variable, fixed = T)] <- 14
df$var_cat[grepl("T4", df$variable, fixed = T)] <- 35
df$var_cat[grepl("T5", df$variable, fixed = T)] <- 56
df$var_cat[grepl("T6", df$variable, fixed = T)] <- 79
df$var_cat <- factor(df$var_cat, levels = c(79,56,35,14,8))
return(df)
}
all.melt <- all.melt %>% fix_rows
all.melt.18s <- all.melt.18s %>% fix_rows
all.melt.both <- all.melt.both %>% fix_rows
# Reverse this category so that it makes a nice triangle on the graph.
all.melt$var_cat <- all.melt$var_cat %>% factor(levels = c(79,56,35,14,8))
all.melt.18s$var_cat <- all.melt.18s$var_cat %>% factor(levels = c(79,56,35,14,8))
all.melt.both$var_cat <- all.melt.both$var_cat %>% factor(levels = c(79,56,35,14,8))
# Better combined graphs
plot_dm <- function(df, ylab = "Sampling Day"){
return(
ggplot(df, aes(y = variable, x = rowname, fill = value)) + geom_raster() +
theme(strip.background = element_blank(),
axis.text = element_blank(),
axis.ticks = element_blank(),
axis.title.x = element_blank(),
panel.grid = element_blank(),
panel.border = element_blank(),
legend.position = c(.95,.4)) +
labs(y = ylab, fill = "Binary \n Jaccard \nDistance") +
facet_grid(var_cat ~ Type + row_cat, scales = "free", switch = "y")
)
}
all.melt %>%
plot_dm(ylab = "Bacteria Sampling Day") +
scale_fill_viridis(limits=c(0,1))
all.melt.18s %>%
plot_dm(ylab = "Eukaryotes Sampling Day") +
scale_fill_viridis(limits=c(0,1), option = "A") # I'm using magma, as plasma was to bright.
all.melt.both %>%
plot_dm + scale_fill_continuous(low = "#222222", high = "#EEEEEE") # use grays for combined plot
While these are not perfect visualizations, they are good reminders that we could compare the average between groups using ANOVA + Tukey test.
all.melt %>% filter(rowname == "T4.14", variable == "T4.19")Questions:
Let’s use the vegan::adonis test to see how much variation of nestedness and turnover can be attributed to sampling day. Note that while Jaccard distances of nestedness add up to total Jaccard distance, these R2 values will not sum up. Rather, this qualitative measurement shows of if sampling day better correlates with nestedness or turnover.
df = as(sample_data(rar.16s.cohort), "data.frame")
day.16s <- rbind(
adonis(rar.16s.cohort.ex.j$beta.jac ~ Day, df)$aov.tab %>% data.frame %>% filter(Df == "4") %>% data.frame(Microbe = "Bacteria", Type = "Total"), # Total .33
adonis(rar.16s.cohort.ex.j$beta.jtu ~ Day, df)$aov.tab %>% data.frame %>% filter(Df == "4") %>% data.frame(Microbe = "Bacteria", Type = "Turnover"), # Turnover .19
adonis(rar.16s.cohort.ex.j$beta.jne ~ Day, df)$aov.tab %>% data.frame %>% filter(Df == "4") %>% data.frame(Microbe = "Bacteria", Type = "Nestedness")# Nestedness .51
)
df = as(sample_data(rar.18s.cohort), "data.frame")
day.18s <- rbind(
adonis(rar.18s.cohort.ex.j$beta.jac ~ Day, df)$aov.tab %>% data.frame %>% filter(Df == "4") %>% data.frame(Microbe = "Eukaryotes", Type = "Total"), # Total .23
adonis(rar.18s.cohort.ex.j$beta.jtu ~ Day, df)$aov.tab %>% data.frame %>% filter(Df == "4") %>% data.frame(Microbe = "Eukaryotes", Type = "Turnover"), # Turnover .25
adonis(rar.18s.cohort.ex.j$beta.jne ~ Day, df)$aov.tab %>% data.frame %>% filter(Df == "4") %>% data.frame(Microbe = "Eukaryotes", Type = "Nestedness") # Nestedness .04
)
# We have to merge the sample_data from 16s and 18s to cover 'both'
df <- df %>% rbind(as(sample_data(rar.16s.cohort), "data.frame"), as(sample_data(rar.18s.cohort), "data.frame")) %>% unique
day.both <- rbind(
adonis(rar.both.ex.j$beta.jac ~ Day, df)$aov.tab %>% data.frame %>% filter(Df == "4") %>% data.frame(Microbe = "Combined", Type = "Total"), # Total .23
adonis(rar.both.ex.j$beta.jtu ~ Day, df)$aov.tab %>% data.frame %>% filter(Df == "4") %>% data.frame(Microbe = "Combined", Type = "Turnover"), # Turnover .25
adonis(rar.both.ex.j$beta.jne ~ Day, df)$aov.tab %>% data.frame %>% filter(Df == "4") %>% data.frame(Microbe = "Combined", Type = "Nestedness") # Nestedness .04
)
rbind(day.16s, day.18s, day.both) %>% kable()
| Df | SumsOfSqs | MeanSqs | F.Model | R2 | Pr..F. | Microbe | Type |
|---|---|---|---|---|---|---|---|
| 4 | 5.7138837 | 1.4284709 | 8.3450911 | 0.3358849 | 0.001 | Bacteria | Total |
| 4 | 1.8046338 | 0.4511584 | 4.1079679 | 0.1993388 | 0.001 | Bacteria | Turnover |
| 4 | 0.8394003 | 0.2098501 | 17.0852862 | 0.5087134 | 0.001 | Bacteria | Nestedness |
| 4 | 4.3456018 | 1.0864005 | 5.0363380 | 0.2365995 | 0.001 | Eukaryotes | Total |
| 4 | 3.2097125 | 0.8024281 | 5.8863480 | 0.2659132 | 0.001 | Eukaryotes | Turnover |
| 4 | -0.0061397 | -0.0015349 | -0.1099199 | -0.0068104 | 0.985 | Eukaryotes | Nestedness |
| 4 | 4.8632051 | 1.2158013 | 4.6864211 | 0.1898380 | 0.001 | Combined | Total |
| 4 | 3.3103050 | 0.8275763 | 4.7370747 | 0.1914970 | 0.001 | Combined | Turnover |
| 4 | 0.2188416 | 0.0547104 | 3.5033644 | 0.1490580 | 0.004 | Combined | Nestedness |
How do we measure the priority effects of the Founder Species?
Nestedness indicates a priority effect.
We already measured this with betapart, but we want a metric which is super simple.
In this section, we will count how many microbes appear at a timepoint that were not in any previous timepoint. We will divide that by the total number of microbes seen so far, to get a metric showing ‘percent new microbes’ which is equal to turnover / dispersion.
“Counting is the hardest part of Bioinformatics” - Lee Ann McCue
Related concepts: - alpha rarefaction asks ‘by what read depth are no new microbes introduced’ while we are asking ‘by what sampling time are no new microbes introduced’. - This is the finite difference of cumulative alpha diversity over time - This is the first derivative of gamma diversity over time
# First, merge by day
rar.16s.cohort.day <- merge_samples(rar.16s.cohort, group = "Day")
total.taxa <- data.frame(Day = factor(c("Day 8", "Day 14", "Day 35", "Day 56", "Day 79"),
levels = c("Day 8", "Day 14", "Day 35", "Day 56", "Day 79")))
total.taxa$`Total OTUs` <- c(
subset_samples(rar.16s.cohort.day, Day %in% 1) %>% filter_taxa(function(x) max(x) > 0, TRUE) %>% ntaxa(),
subset_samples(rar.16s.cohort.day, Day %in% 1:2) %>% filter_taxa(function(x) max(x) > 0, TRUE) %>% ntaxa(),
subset_samples(rar.16s.cohort.day, Day %in% 1:3) %>% filter_taxa(function(x) max(x) > 0, TRUE) %>% ntaxa(),
subset_samples(rar.16s.cohort.day, Day %in% 1:4) %>% filter_taxa(function(x) max(x) > 0, TRUE) %>% ntaxa(),
subset_samples(rar.16s.cohort.day, Day %in% 1:5) %>% filter_taxa(function(x) max(x) > 0, TRUE) %>% ntaxa()
)
# sanity check
rar.16s.cohort.day %>% filter_taxa(function(x) max(x) > 0, TRUE) %>% ntaxa() # Good. We got all 5 days.
## [1] 2373
subset_samples(rar.16s.cohort.day, Day %in% 1) %>% estimate_richness() # We are reporting all Observed OTUs.
## Observed Chao1 se.chao1 ACE se.ACE Shannon Simpson InvSimpson
## X8 1013 1412 57.76353 1431.127 20.55871 3.917381 0.9235087 13.07338
## Fisher
## X8 178.3945
rar.16s.cohort.day %>% ntaxa # and the difference between our count and the total...
## [1] 2413
rar.16s.cohort.day %>% taxa_sums() %>% table %>% head # ... is equal to the number of 0s in our table
## .
## 0 1 2 3 4 5
## 40 493 261 200 153 103
total.taxa$`New OTUs` <- total.taxa$`Total OTUs` - lag(total.taxa$`Total OTUs`)
#total.taxa
# 18s
rar.18s.cohort.day <- merge_samples(rar.18s.cohort, group = "Day")
total.euks <- data.frame(Day = factor(c("Day 8", "Day 14", "Day 35", "Day 56", "Day 79"),
levels = c("Day 8", "Day 14", "Day 35", "Day 56", "Day 79")))
total.euks$`Total OTUs` <- c(
subset_samples(rar.18s.cohort.day, Day %in% 1) %>% filter_taxa(function(x) max(x) > 0, TRUE) %>% ntaxa(),
subset_samples(rar.18s.cohort.day, Day %in% 1:2) %>% filter_taxa(function(x) max(x) > 0, TRUE) %>% ntaxa(),
subset_samples(rar.18s.cohort.day, Day %in% 1:3) %>% filter_taxa(function(x) max(x) > 0, TRUE) %>% ntaxa(),
subset_samples(rar.18s.cohort.day, Day %in% 1:4) %>% filter_taxa(function(x) max(x) > 0, TRUE) %>% ntaxa(),
subset_samples(rar.18s.cohort.day, Day %in% 1:5) %>% filter_taxa(function(x) max(x) > 0, TRUE) %>% ntaxa()
)
total.euks$`New OTUs` <- total.euks$`Total OTUs` - lag(total.euks$`Total OTUs`)
total.euks
## Day Total OTUs New OTUs
## 1 Day 8 816 NA
## 2 Day 14 1587 771
## 3 Day 35 1979 392
## 4 Day 56 2042 63
## 5 Day 79 2096 54
# Combined
total.combined <- data.frame(Day = factor(c("Day 8", "Day 14", "Day 35", "Day 56", "Day 79"),
levels = c("Day 8", "Day 14", "Day 35", "Day 56", "Day 79")))
total.combined$`Total OTUs` <- total.taxa$`Total OTUs` + total.euks$`Total OTUs`
total.combined$`New OTUs` <- total.taxa$`New OTUs` + total.euks$`New OTUs`
total.combined$Type <- "Combined"
total.taxa$Type <- "Bacteria"
total.euks$Type <- "Eukaryotes"
total.all <- rbind(total.combined, total.taxa, total.euks)
# Replace NA (all OTUs are new at the first timepoint)
total.all$`New OTUs`[is.na(total.all$`New OTUs`)] <- total.all$`Total OTUs`[is.na(total.all$`New OTUs`)]
# calculate observed turnover
total.all$`Percent New OTUs` <- total.all$`New OTUs` / total.all$`Total OTUs`
# reorder levels
total.all$Type <- total.all$Type %>% factor(levels = c("Bacteria", "Eukaryotes", "Combined"))
# rename variables
total.all$`Sum of all observed OTUs` <- total.all$`Total OTUs`
total.all$`Sum of previously unobserved OTUs` <- total.all$`New OTUs`
total.all$`Fraction of community composed of\npreviously unobserved OTUs ` <- total.all$`Percent New OTUs`
# Optional: remove old variables
total.all$`Total OTUs` <- NULL
total.all$`New OTUs` <- NULL
total.all$`Percent New OTUs` <- NULL
total.all.m <- melt(total.all)
## Using Day, Type as id variables
total.all.m$variable <- factor(total.all.m$variable, levels = levels(total.all.m$variable)[c(3,2,1)])
total.all.m %>%
ggplot(aes(x = Day, y = value, color = Type)) +
geom_point(alpha = .9) +
geom_line(aes(group = Type), size = 1, alpha = .5) +
facet_wrap(~variable, scales = "free_y") +
#scale_color_manual(values = c("#5DC863", "#B52F8C", "#777777")) +
scale_color_manual(values = c("#6DCD59", "#9F2F7FFF", "#777777")) +
theme(axis.title = element_blank(),
# legend.position = c(.92,.6), # legend in the left panel
legend.position = c(.22,.62), # legend in the right panel
legend.title = element_blank()
#, panel.spacing.x = unit(30, "pt") # add spacing between plots for equations
)
# viridis(10, option = "D")[8]
# viridis(10, option = "A")[5]
total.all.m %>% filter(Type == "Combined", Day == "Day 56")
## Day Type
## 1 Day 56 Combined
## 2 Day 56 Combined
## 3 Day 56 Combined
## variable
## 1 Sum of all observed OTUs
## 2 Sum of previously unobserved OTUs
## 3 Fraction of community composed of\npreviously unobserved OTUs
## value
## 1 4.335000e+03
## 2 1.450000e+02
## 3 3.344867e-02
Are the selective pressures resulting in nestedness and turnover related to phylogenetic composition / functional niche of the microbes? Beta NTI shows us if phylogenetic turnover is caused by niche-based processes.
The following code was provided by Emily B. Graham and used with her guidance and permission. We have modified it slightly. It is related to script from James Stegen’s script from ISME 2013, which is available on GitHub.
run_beta_nti <- function(phylo, otu, reps = 999){
#phylo is phylogentic tree
#otu is otu matrix
match.phylo.otu.trim = match.phylo.data(phylo, t(otu))#trims tree to only otus in otu table
beta.type = 'bNTI';#set to calculate bNTI
beta.reps = reps;#set reps
emp.weighted.neighbor.trim =
as.matrix(comdistnt(t(match.phylo.otu.trim$data),
cophenetic(match.phylo.otu.trim$phy),
abundance.weighted=T,
exclude.conspecifics = F))
## empirical mean neighbor
#print(emp.weighted.neighbor.trim)
rand.weighted.neighbor.comp.trim =
array(c(-999), dim=c(nrow(otu), nrow(otu), beta.reps))
#print(dim(rand.weighted.neighbor.comp.trim))
for (b.rep in 1:beta.reps) {
rand.weighted.neighbor.comp.trim[,,b.rep] =
as.matrix(comdistnt(t(match.phylo.otu.trim$data),
taxaShuffle(cophenetic(match.phylo.otu.trim$phy)),
abundance.weighted=T, exclude.conspecifics = F))
print(c(b.rep, date()))
}
#lapply version of the above loop
# lapply(1:beta.reps, function(b.rep){
# rand.weighted.neighbor.comp.trim[,,b.rep] =
# as.matrix(comdistnt(t(match.phylo.otu.trim$data),
# taxaShuffle(cophenetic(match.phylo.otu.trim$phy)),
# abundance.weighted=T, exclude.conspecifics = F))
# print(c(b.rep, date()))
# })
#print(rand.weighted.neighbor.comp.trim)
ses.weighted.neighbor.trim = matrix(c(NA),nrow=nrow(otu),ncol=nrow(otu));
for (columns in 1:(nrow(otu)-1)) {
for (rows in (columns+1):nrow(otu)) {
rand.vals = rand.weighted.neighbor.comp.trim[rows,columns,];
ses.weighted.neighbor.trim[rows,columns] = (emp.weighted.neighbor.trim[rows,columns] - mean(rand.vals)) / sd(rand.vals);
rm("rand.vals");
};
};
rownames(ses.weighted.neighbor.trim) = rownames(otu)
colnames(ses.weighted.neighbor.trim) = rownames(otu)
print(ses.weighted.neighbor.trim[1:5, 1:5])
return(ses.weighted.neighbor.trim)
}
# We will export these again, this time without filtering for singletons
rar.16s.cohort.ex <- rar.16s.cohort %>% filter_taxa(flist = function(x) max(x) > 0, prune = T) %>% phyloseq_to_picante # 2373 taxa
rar.16s.cohort.bnti <- run_beta_nti(rar.16s.cohort.ex@phy, rar.16s.cohort.ex@otu, 99)
rar.16s.cohort.bnti %>% write.csv("rar.16s.cohort.bnti.csv", F, F, row.names = T, col.names = T)
## Warning in write.csv(., "rar.16s.cohort.bnti.csv", F, F, row.names = T, :
## attempt to set 'col.names' ignored
Repeat this for 18S.
# We will export these again, this time without filtering for singletons
rar.18s.cohort.ex <- rar.18s.cohort %>% filter_taxa(flist = function(x) max(x) > 0, prune = T) %>% phyloseq_to_picante # 2373 taxa
rar.18s.cohort.bnti <- run_beta_nti(rar.18s.cohort.ex@phy, rar.18s.cohort.ex@otu, 99)
rar.18s.cohort.bnti[20:25,20:25]
rar.18s.cohort.bnti %>% write.csv("rar.18s.cohort.bnti.csv", F, F, row.names = T, col.names = T)
## Warning in write.csv(., "rar.18s.cohort.bnti.csv", F, F, row.names = T, :
## attempt to set 'col.names' ignored
beta NTI graphs for 16s
rar.16s.cohort.bnti <- read.csv("rar.16s.cohort.bnti.csv", row.names = 1)
rar.16s.cohort.bnti[20:25,20:25]
## T5.6 T5.4 T3.20 T5.20 T2..16.20 T6.16
## T5.6 NA NA NA NA NA NA
## T5.4 -0.9829618 NA NA NA NA NA
## T3.20 0.3215082 -1.435883 NA NA NA NA
## T5.20 -2.6627708 -2.884108 -2.6605155 NA NA NA
## T2..16.20 -1.6220767 -1.565833 -0.3143966 -2.515564 NA NA
## T6.16 -0.5134339 -1.449874 0.1357266 -3.366689 -1.307931 NA
rar.16s.cohort.bnti.melt <- rar.16s.cohort.bnti %>% as.dist() %>% distmelt() %>% fix_rows()
## Using rowname as id variables
rar.16s.cohort.bnti.melt$Type <- "16S"
rar.16s.cohort.bnti.melt %>% arrange(-value) %>% head
## rowname variable value row_cat var_cat Type
## 1 T4.2 T5.3 4.451746 35 56 16S
## 2 T5.2 T6.2 4.330486 56 79 16S
## 3 T4.2 T5.1 3.593825 35 56 16S
## 4 T2..6.10 T3.15 3.443055 8 14 16S
## 5 T4.2 T5.2 3.267542 35 56 16S
## 6 T4.2 T4.22 3.241802 35 35 16S
rar.16s.cohort.bnti.melt %>%
ggplot(aes(y = variable, x = rowname, fill = value)) + geom_raster() +
theme(strip.background = element_blank(),
axis.text = element_blank(),
axis.ticks = element_blank(),
axis.title.x = element_blank(),
panel.grid = element_blank(),
panel.border = element_blank(),
legend.position = c(.95,.4)) +
labs(y = "Sampling Day", fill = "beta NTI") +
facet_grid(var_cat ~ Type + row_cat, scales = "free", switch = "y") +
scale_fill_gradient2(limits = c(-6, 6))
# This shows low turnover, just like we have already shown.
beta NTI graphs for 18s
rar.18s.cohort.bnti <- read.csv("rar.18s.cohort.bnti.csv", row.names = 1)
rar.18s.cohort.bnti.melt <- rar.18s.cohort.bnti %>% as.dist() %>% distmelt() %>% fix_rows()
## Using rowname as id variables
rar.18s.cohort.bnti.melt$Type <- "18S"
rar.18s.cohort.bnti.melt %>% arrange(abs(value)) %>% tail
## rowname variable value row_cat var_cat Type
## 2410 T5.7 T5.8 9.085444 56 56 18S
## 2411 T5.4 T5.9 9.334585 56 56 18S
## 2412 T5.17 T5.9 9.384213 56 56 18S
## 2413 T5.4 T5.8 9.563815 56 56 18S
## 2414 T2..2.5 T5.17 10.790625 8 56 18S
## 2415 T5.17 T5.8 10.878156 56 56 18S
rar.18s.cohort.bnti.melt %>%
ggplot(aes(y = variable, x = rowname, fill = value)) + geom_raster() +
theme(strip.background = element_blank(),
axis.text = element_blank(),
axis.ticks = element_blank(),
axis.title.x = element_blank(),
panel.grid = element_blank(),
panel.border = element_blank(),
legend.position = c(.95,.4)) +
labs(y = "Sampling Day", fill = "beta NTI") +
facet_grid(var_cat ~ Type + row_cat, scales = "free", switch = "y") +
scale_fill_gradient2(limits = c(-6, 6))
Part of the nestedness / turnover figure.
rar.16s.cohort.bnti.melt$microbe <- "16S"
rar.18s.cohort.bnti.melt$microbe <- "18S"
bnti.melt <- rbind(rar.16s.cohort.bnti.melt, rar.18s.cohort.bnti.melt)
bnti.melt %>% filter(row_cat == var_cat) %>% dplyr::select(value) %>% summary
## value
## Min. :-4.8191
## 1st Qu.:-1.9136
## Median :-0.4859
## Mean :-0.1691
## 3rd Qu.: 1.5236
## Max. :10.8782
bnti.melt %>% filter(microbe == "16S" & row_cat == var_cat) %>%
ggplot(aes(y = value, x = as.numeric(as.character(var_cat)))) +
geom_hline(yintercept = c(0, 2, -2), color = "blue", alpha = 0.6) +
geom_boxplot(aes(group = var_cat), outlier.alpha = 0) + geom_jitter(width = .5, alpha = .1) +
geom_smooth(color = "#6DCD59", method = "lm", size = 1, se = F) +
#facet_grid(~microbe) +
labs(x = "Bacteria Sampling Day", y = "BetaNTI") +
scale_y_continuous(limits = c(-6, 9)) +
theme(strip.background = element_blank())
bnti.melt %>% filter(microbe == "18S" & row_cat == var_cat) %>%
ggplot(aes(y = value, x = as.numeric(as.character(var_cat)))) +
geom_hline(yintercept = c(0, 2, -2), color = "blue", alpha = 0.6) +
geom_boxplot(aes(group = var_cat), outlier.alpha = 0) + geom_jitter(width = .5, alpha = .1) +
geom_smooth(color = "#9F2F7F", method = "lm", size = 1, se = F) +
#facet_grid(~microbe) +
labs(x = "Eukaryotes Sampling Day", y = "BetaNTI") +
scale_y_continuous(limits = c(-6, 9)) +
theme(strip.background = element_blank())
GLM, with with all vs all pairwise post-hoc Tukey test
bnti.melt %>%
filter(microbe == "16S" & row_cat == var_cat) %>%
glm(value ~ var_cat, "gaussian", .) %>%
glht(linfct = mcp(var_cat = "Tukey")) %>%
summary %>% tidy %>% kable
| lhs | rhs | estimate | std.error | statistic | p.value |
|---|---|---|---|---|---|
| 56 - 79 | 0 | 0.9025516 | 0.1519757 | 5.9387887 | 0.0000000 |
| 35 - 79 | 0 | 1.5369807 | 0.1566530 | 9.8113736 | 0.0000000 |
| 14 - 79 | 0 | 2.1321611 | 0.1759679 | 12.1167641 | 0.0000000 |
| 8 - 79 | 0 | 1.9381438 | 0.5531999 | 3.5035145 | 0.0035058 |
| 35 - 56 | 0 | 0.6344292 | 0.1566530 | 4.0499023 | 0.0003680 |
| 14 - 56 | 0 | 1.2296095 | 0.1759679 | 6.9876937 | 0.0000000 |
| 8 - 56 | 0 | 1.0355923 | 0.5531999 | 1.8720038 | 0.3039592 |
| 14 - 35 | 0 | 0.5951804 | 0.1800229 | 3.3061378 | 0.0069723 |
| 8 - 35 | 0 | 0.4011631 | 0.5545031 | 0.7234642 | 0.9450248 |
| 8 - 14 | 0 | -0.1940172 | 0.5602662 | -0.3462948 | 0.9964772 |
bnti.melt %>%
filter(microbe == "18S" & row_cat == var_cat) %>%
glm(value ~ var_cat, "gaussian", .) %>%
glht(linfct = mcp(var_cat = "Tukey")) %>%
summary %>% tidy %>% kable
| lhs | rhs | estimate | std.error | statistic | p.value |
|---|---|---|---|---|---|
| 56 - 79 | 0 | 0.9123955 | 0.3170337 | 2.8779135 | 0.0276835 |
| 35 - 79 | 0 | 1.2940963 | 0.3049787 | 4.2432344 | 0.0001714 |
| 14 - 79 | 0 | 1.3077108 | 0.3170337 | 4.1248326 | 0.0002664 |
| 8 - 79 | 0 | 2.1190620 | 0.9456534 | 2.2408444 | 0.1454160 |
| 35 - 56 | 0 | 0.3817008 | 0.2564584 | 1.4883537 | 0.5396803 |
| 14 - 56 | 0 | 0.3953153 | 0.2706829 | 1.4604372 | 0.5583173 |
| 8 - 56 | 0 | 1.2066666 | 0.9311386 | 1.2959043 | 0.6675753 |
| 14 - 35 | 0 | 0.0136145 | 0.2564584 | 0.0530867 | 0.9999979 |
| 8 - 35 | 0 | 0.8249657 | 0.9271035 | 0.8898313 | 0.8892059 |
| 8 - 14 | 0 | 0.8113512 | 0.9311386 | 0.8713538 | 0.8965185 |
For each of our Founders Species, let’s see how their mean abundances changes with betaNTI. A positive slope (high abundance with high betaNTI), means that the microbe is most successful in a stochastic, high turnover environment. A negative slope (high abundance with negative betaNTI), means that the microbe is most successful in a stable environment with low turnover.
# It turns out that getting the mean values from all pairs in a vector is
# really hard. Here is the solution I like. This is stylistically dplyr / TidyR
# select.16s.melt is our starting object, which is the founders species from the
# line plots, melted into a data frame.
# select.16s.melt %>% head
# First, we will group_by to denote that each sample appears once for each microbe,
# then we will select the Sample, Abundance, and (implicitly) the Taxonomy columns.
s.a.16s <- select.16s.melt %>% group_by(Taxonomy) %>% dplyr::select(Sample1 = Sample, Abundance)
## Adding missing grouping variables: `Taxonomy`
s.a.16s
## # A tibble: 568 x 3
## # Groups: Taxonomy [8]
## Taxonomy Sample1 Abundance
## * <chr> <chr> <dbl>
## 1 Rhodobacterales, Rhodobacteraceae, Rhodobaca T5.8 0.7962591
## 2 Rhodobacterales, Rhodobacteraceae, Rhodobaca T5.7 0.7887118
## 3 Rhodobacterales, Rhodobacteraceae, Rhodobaca T5.17 0.7885346
## 4 Rhodobacterales, Rhodobacteraceae, Rhodobaca T5.9 0.7729562
## 5 Rhodobacterales, Rhodobacteraceae, Rhodobaca T5.4 0.7573969
## 6 Rhodobacterales, Rhodobacteraceae, Rhodobaca T5.11 0.7543247
## 7 Rhodobacterales, Rhodobacteraceae, Rhodobaca T5.10 0.7528807
## 8 Rhodobacterales, Rhodobacteraceae, Rhodobaca T5.20 0.7437588
## 9 Rhodobacterales, Rhodobacteraceae, Rhodobaca T5.13 0.7349692
## 10 Rhodobacterales, Rhodobacteraceae, Rhodobaca T5.19 0.7346133
## # ... with 558 more rows
# Look at that! It's now a tibble, and also we renamed the Sample to Sample1
# Let's a make a copy of this object...
s.a.16s.dup <- s.a.16s
names(s.a.16s.dup) <- c("Taxonomy", "Sample2", "Abundance2")
# ... and also rename these to Sample2 and Abidance2.
select.16s.mean <-
s.a.16s %>%
expand(Sample1, Sample2 = Sample1) %>% # generate all pairs of sample1 (but save the second pair as sample2!!!)
inner_join(s.a.16s) %>% # join in Abundance for Sample1
inner_join(s.a.16s.dup) %>% # join in Abundance2 for Sample2
mutate(abmean = (Abundance + Abundance2) / 2 ) %>% # calculate the mean of these two values.
dplyr::select(Taxonomy, rowname = Sample1, variable = Sample2, abmean) # drop extra columns and rename
## Joining, by = c("Taxonomy", "Sample1")
## Joining, by = c("Taxonomy", "Sample2")
select.16s.mean
## # A tibble: 40,328 x 4
## # Groups: Taxonomy [8]
## Taxonomy rowname variable abmean
## <chr> <chr> <chr> <dbl>
## 1 [Rhodothermales], [Balneolaceae], KSA1 T2..11.15 T2..11.15 0.02167282
## 2 [Rhodothermales], [Balneolaceae], KSA1 T2..11.15 T2..16.20 0.01838702
## 3 [Rhodothermales], [Balneolaceae], KSA1 T2..11.15 T2..2.5 0.02125144
## 4 [Rhodothermales], [Balneolaceae], KSA1 T2..11.15 T2..6.10 0.01795785
## 5 [Rhodothermales], [Balneolaceae], KSA1 T2..11.15 T3.1 0.01749946
## 6 [Rhodothermales], [Balneolaceae], KSA1 T2..11.15 T3.10 0.01758421
## 7 [Rhodothermales], [Balneolaceae], KSA1 T2..11.15 T3.12 0.01697354
## 8 [Rhodothermales], [Balneolaceae], KSA1 T2..11.15 T3.13 0.01681531
## 9 [Rhodothermales], [Balneolaceae], KSA1 T2..11.15 T3.14 0.01641422
## 10 [Rhodothermales], [Balneolaceae], KSA1 T2..11.15 T3.15 0.01802113
## # ... with 40,318 more rows
# Admire that it worked. Thank you Hadley.
# Repeat for 18S
s.a.18s <- select.18s.melt %>% group_by(Taxonomy) %>% dplyr::select(Sample1 = Sample, Abundance)
## Adding missing grouping variables: `Taxonomy`
s.a.18s.dup <- s.a.18s
names(s.a.18s.dup) <- c("Taxonomy", "Sample2", "Abundance2")
select.18s.mean <-
s.a.18s %>%
expand(Sample1, Sample2 = Sample1) %>% # generate all pairs of sample1 (but save the second pair as sample2!!!)
inner_join(s.a.18s) %>% # join in Abundance for Sample1
inner_join(s.a.18s.dup) %>% # join in Abundance2 for Sample2
mutate(abmean = (Abundance + Abundance2) / 2 ) %>% # calculate the mean of these two values.
dplyr::select(Taxonomy, rowname = Sample1, variable = Sample2, abmean) # drop extra columns and rename
## Joining, by = c("Taxonomy", "Sample1")
## Joining, by = c("Taxonomy", "Sample2")
# 18S is done!
The ‘median of mean’ is really inelegant. The fact that each point represents a pair of samples is super strange.
Let’s recalculate the median RA so it’s simple and it matches the line graphs better.
# Subset and summarize betaNTI
select.16s.bNTImed <- select.16s.mean %>%
left_join(bnti.melt) %>%
filter(row_cat == var_cat) %>%
group_by(Taxonomy, Day = factor(row_cat)) %>%
summarise(betaNTImedian = median(value))
## Joining, by = c("rowname", "variable")
# Subset and summarize abundance
select.16s.abmed <- select.16s.melt %>%
group_by(Taxonomy, Day) %>%
summarise(AbundanceMedian = median(Abundance))
# Merge and graph
inner_join(select.16s.bNTImed, select.16s.abmed) %>%
ggplot(aes(betaNTImedian, AbundanceMedian, label = Day)) +
geom_vline(xintercept = 0, color = "red", alpha = 0.2) +
geom_point() + geom_smooth(method = "lm") +
geom_label(nudge_y = 0.2) +
facet_wrap(~Taxonomy, ncol = 2) +
labs(x = "median betaNTI", y = "median relative abundances") #, title = "16S: Within each timepoint")
## Joining, by = c("Taxonomy", "Day")
# Stat test on slope
inner_join(select.16s.bNTImed, select.16s.abmed) %>%
do(tidy(lm(data = ., AbundanceMedian ~ betaNTImedian))) %>%
filter(term == "betaNTImedian") %>% kable()
## Joining, by = c("Taxonomy", "Day")
| Taxonomy | term | estimate | std.error | statistic | p.value |
|---|---|---|---|---|---|
| [Rhodothermales], [Balneolaceae], KSA1 | betaNTImedian | -0.0518692 | 0.0185886 | -2.7903743 | 0.0683976 |
| GMD14H09, | betaNTImedian | -0.0208858 | 0.0081295 | -2.5691527 | 0.0825539 |
| Oceanospirillales, Saccharospirillaceae, Saccharospirillum | betaNTImedian | -0.0523754 | 0.0077333 | -6.7727406 | 0.0065781 |
| Pirellulales, Pirellulaceae, | betaNTImedian | 0.0109120 | 0.0026223 | 4.1612002 | 0.0252443 |
| Pseudanabaenales, Pseudanabaenaceae, | betaNTImedian | 0.1572082 | 0.0658830 | 2.3861722 | 0.0970757 |
| Rhodobacterales, Rhodobacteraceae, | betaNTImedian | 0.0190340 | 0.0021474 | 8.8639488 | 0.0030272 |
| Rhodobacterales, Rhodobacteraceae, Rhodobaca | betaNTImedian | -0.1659686 | 0.1337242 | -1.2411260 | 0.3027636 |
| Sphingomonadales, Erythrobacteraceae, Erythrobacter | betaNTImedian | 0.0117304 | 0.0184696 | 0.6351182 | 0.5704810 |
# Subset and summarize betaNTI
select.18s.bNTImed <- select.18s.mean %>%
left_join(bnti.melt) %>%
filter(row_cat == var_cat) %>%
group_by(Taxonomy, Day = factor(row_cat)) %>%
summarise(betaNTImedian = median(value))
## Joining, by = c("rowname", "variable")
# Subset and summarize abundance
select.18s.abmed <- select.18s.melt %>%
group_by(Taxonomy, Day) %>%
summarise(AbundanceMedian = median(Abundance))
# Merge and graph
inner_join(select.18s.bNTImed, select.18s.abmed) %>%
ggplot(aes(betaNTImedian, AbundanceMedian, label = Day)) +
geom_vline(xintercept = 0, color = "red", alpha = 0.2) +
geom_point() + geom_smooth(method = "lm") +
geom_label(nudge_y = 0.2) +
facet_wrap(~Taxonomy, ncol = 2) +
labs(x = "median betaNTI", y = "median relative abundances") #, title = "18S: Within each timepoint")
## Joining, by = c("Taxonomy", "Day")
# Stat test on slope
inner_join(select.18s.bNTImed, select.18s.abmed) %>%
do(tidy(lm(data = ., AbundanceMedian ~ betaNTImedian))) %>%
filter(term == "betaNTImedian") %>% kable()
## Joining, by = c("Taxonomy", "Day")
| Taxonomy | term | estimate | std.error | statistic | p.value |
|---|---|---|---|---|---|
| Charophyta, Pinales, Pinus | betaNTImedian | 0.0070343 | 0.0044733 | 1.572514 | 0.2138811 |
| Chlorophyta, Chlamydomonadales, Dunaliella | betaNTImedian | 0.0083782 | 0.0029584 | 2.831981 | 0.0660816 |
| D226, uncultured eukaryote, uncultured eukaryote | betaNTImedian | 0.1556610 | 0.0305110 | 5.101796 | 0.0145637 |
| Labyrinthulomycetes, Thraustochytriaceae, Aplanochytrium | betaNTImedian | 0.0916635 | 0.0588875 | 1.556586 | 0.2174319 |
| Ochrophyta, Bacillariophyceae, Pseudo-nitzschia | betaNTImedian | -0.0298699 | 0.0185013 | -1.614473 | 0.2048330 |
| Ochrophyta, Chromulinales, Chrysoxys | betaNTImedian | -0.3084124 | 0.0598534 | -5.152795 | 0.0141704 |
| Protalveolata, Syndiniales, Syndiniales Group II | betaNTImedian | 0.0301071 | 0.0175265 | 1.717807 | 0.1843294 |